ID: 1152655376_1152655387

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1152655376 1152655387
Species Human (GRCh38) Human (GRCh38)
Location 17:81517010-81517032 17:81517059-81517081
Sequence CCTGGGTCAGGGTAATTAGCCAG GAAGGTTCTGGAGGGCGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 68} {0: 1, 1: 0, 2: 3, 3: 31, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!