ID: 1152659169_1152659176

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1152659169 1152659176
Species Human (GRCh38) Human (GRCh38)
Location 17:81534538-81534560 17:81534556-81534578
Sequence CCTCCCCCAGGGGTCCTGGGAGA GGAGACCAAGCACAGATGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 402} {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!