ID: 1152662988_1152663001

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152662988 1152663001
Species Human (GRCh38) Human (GRCh38)
Location 17:81551633-81551655 17:81551684-81551706
Sequence CCTCGGGGGCGTGTCTCACCAGA CAGGATCCCGCGCCCCGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 59} {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!