ID: 1152690155_1152690168

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152690155 1152690168
Species Human (GRCh38) Human (GRCh38)
Location 17:81714273-81714295 17:81714325-81714347
Sequence CCTACTGCCGGGAGCTCTCAGCT GTGGTGGAGGCCAACAGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140} {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!