ID: 1152748332_1152748357

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152748332 1152748357
Species Human (GRCh38) Human (GRCh38)
Location 17:82051403-82051425 17:82051448-82051470
Sequence CCCGCGCGGAGCCTCCGGGGGCC AGGCGGGGCGGGTGGGCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231} {0: 1, 1: 0, 2: 5, 3: 95, 4: 1436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!