ID: 1152760969_1152760977

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1152760969 1152760977
Species Human (GRCh38) Human (GRCh38)
Location 17:82106881-82106903 17:82106912-82106934
Sequence CCAGGTCTGCCAGGCCAGCTTAC GTGGGCACCCTAGCATCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 139} {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!