ID: 1152809544_1152809548

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152809544 1152809548
Species Human (GRCh38) Human (GRCh38)
Location 17:82375071-82375093 17:82375087-82375109
Sequence CCGGCGGCCGGGGGCGCGCGCGC CGCGCGCTGCGCCTGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 440} {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!