ID: 1152809544_1152809550

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152809544 1152809550
Species Human (GRCh38) Human (GRCh38)
Location 17:82375071-82375093 17:82375106-82375128
Sequence CCGGCGGCCGGGGGCGCGCGCGC TGGGCATCGTGCTGCTCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 440} {0: 1, 1: 0, 2: 3, 3: 12, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!