ID: 1152847561_1152847570

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152847561 1152847570
Species Human (GRCh38) Human (GRCh38)
Location 17:82611358-82611380 17:82611398-82611420
Sequence CCTGTAGTCCCGGCTACTCAGGA CACGTGAATCCAGGAGACAGAGG
Strand - +
Off-target summary {0: 307, 1: 42666, 2: 160695, 3: 220202, 4: 208068} {0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!