|
Left Crispr |
Right Crispr |
Crispr ID |
1152847561 |
1152847570 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:82611358-82611380
|
17:82611398-82611420
|
Sequence |
CCTGTAGTCCCGGCTACTCAGGA |
CACGTGAATCCAGGAGACAGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 307, 1: 42666, 2: 160695, 3: 220202, 4: 208068} |
{0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|