ID: 1152847565_1152847570

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1152847565 1152847570
Species Human (GRCh38) Human (GRCh38)
Location 17:82611367-82611389 17:82611398-82611420
Sequence CCGGCTACTCAGGAGGCTGAGGT CACGTGAATCCAGGAGACAGAGG
Strand - +
Off-target summary {0: 12610, 1: 113153, 2: 218440, 3: 237917, 4: 144947} {0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!