ID: 1152888950_1152888962

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1152888950 1152888962
Species Human (GRCh38) Human (GRCh38)
Location 17:82869057-82869079 17:82869100-82869122
Sequence CCACCTGGGGAGGAGTGCTTATC GGAGGCTTGGGTGCTCCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141} {0: 1, 1: 0, 2: 2, 3: 12, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!