ID: 1152896469_1152896482

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1152896469 1152896482
Species Human (GRCh38) Human (GRCh38)
Location 17:82914217-82914239 17:82914264-82914286
Sequence CCATCCGGGTTCTCGGTGCTCTG GGTCTGTTGTTGGGGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96} {0: 1, 1: 0, 2: 1, 3: 21, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!