ID: 1152927357_1152927365

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152927357 1152927365
Species Human (GRCh38) Human (GRCh38)
Location 17:83093384-83093406 17:83093406-83093428
Sequence CCCTCCACCAGCCCTGGGGACAG GGGACGCCACCGCCCACACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 548} {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!