ID: 1152956843_1152956853

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1152956843 1152956853
Species Human (GRCh38) Human (GRCh38)
Location 18:47769-47791 18:47798-47820
Sequence CCCCTGAAAATGGCAGCCACCGT GCAGCCGTGACGGGGGTCACAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 6, 3: 18, 4: 113} {0: 1, 1: 5, 2: 1, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!