ID: 1153521091_1153521096

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1153521091 1153521096
Species Human (GRCh38) Human (GRCh38)
Location 18:5954541-5954563 18:5954568-5954590
Sequence CCTGCTTCCCTTGGGAAATATAT AGAAAGACAGCACTCCAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195} {0: 1, 1: 0, 2: 2, 3: 33, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!