ID: 1153636483_1153636493

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1153636483 1153636493
Species Human (GRCh38) Human (GRCh38)
Location 18:7117607-7117629 18:7117626-7117648
Sequence CCCGCCCGCCCGCCTGCGGGGGA GGGACAGGGACCCTAGGACCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 22, 4: 291} {0: 1, 1: 0, 2: 0, 3: 25, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!