ID: 1153805473_1153805480

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1153805473 1153805480
Species Human (GRCh38) Human (GRCh38)
Location 18:8705882-8705904 18:8705903-8705925
Sequence CCCGCGCTCGCCCAACCTCGCGG GGGCAAAGCGCCGCCCTCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!