ID: 1153813311_1153813319

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1153813311 1153813319
Species Human (GRCh38) Human (GRCh38)
Location 18:8770962-8770984 18:8771008-8771030
Sequence CCTCTTATGGCATAATATTTAGA ATGAGTGAACAGGAGGAAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!