ID: 1155055272_1155055276

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1155055272 1155055276
Species Human (GRCh38) Human (GRCh38)
Location 18:22176927-22176949 18:22176941-22176963
Sequence CCGCCCTCACGCACCGCTGTCGC CGCTGTCGCCGCAGACCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80} {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!