ID: 1155175532_1155175536

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1155175532 1155175536
Species Human (GRCh38) Human (GRCh38)
Location 18:23298245-23298267 18:23298258-23298280
Sequence CCTCAGGTACACATGGGAGGTGA TGGGAGGTGAGAAGGCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183} {0: 1, 1: 2, 2: 10, 3: 198, 4: 1618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!