ID: 1155199375_1155199391

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1155199375 1155199391
Species Human (GRCh38) Human (GRCh38)
Location 18:23503731-23503753 18:23503759-23503781
Sequence CCCGCGCTTCCTCCCCCGCGCGG CCGGGGTCGTGGGCGCGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 229} {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!