ID: 1155556118_1155556122

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1155556118 1155556122
Species Human (GRCh38) Human (GRCh38)
Location 18:27021092-27021114 18:27021113-27021135
Sequence CCTTATGTGCTAGGGAAGAATGA GAAAGTTCAAGTGAAAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!