ID: 1155617262_1155617264

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1155617262 1155617264
Species Human (GRCh38) Human (GRCh38)
Location 18:27736877-27736899 18:27736910-27736932
Sequence CCAGATTCCAGCTTTCTGGGGCT CTTTTCTGCTTGAAGTGTATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!