ID: 1155623347_1155623348

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1155623347 1155623348
Species Human (GRCh38) Human (GRCh38)
Location 18:27806844-27806866 18:27806861-27806883
Sequence CCTGAGAAATCTACAGTCAGTGC CAGTGCAAAGAATCTGATGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 34, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!