ID: 1155753037_1155753040

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1155753037 1155753040
Species Human (GRCh38) Human (GRCh38)
Location 18:29453253-29453275 18:29453284-29453306
Sequence CCCTAAACAAGTGGGAGCATTAC CTTTATGTGTAGGCTGCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 6, 3: 17, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!