ID: 1155873910_1155873911

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1155873910 1155873911
Species Human (GRCh38) Human (GRCh38)
Location 18:31061434-31061456 18:31061472-31061494
Sequence CCATACGGAGGCACATCAGTGAG CTCACGTATACCTAGAATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60} {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!