ID: 1156012629_1156012641

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1156012629 1156012641
Species Human (GRCh38) Human (GRCh38)
Location 18:32512449-32512471 18:32512471-32512493
Sequence CCCTCCCCCTGGTCCACCCCCTC CCTCAAGTCGTGCAGATGTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 140, 4: 1535} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!