ID: 1156481444_1156481448

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1156481444 1156481448
Species Human (GRCh38) Human (GRCh38)
Location 18:37439047-37439069 18:37439061-37439083
Sequence CCTCAGTCCTGATGCTGGAACTG CTGGAACTGCAGAGGGCCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!