ID: 1156519357_1156519362

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1156519357 1156519362
Species Human (GRCh38) Human (GRCh38)
Location 18:37708727-37708749 18:37708755-37708777
Sequence CCTTCCTCTCTCCACTTCTCTAT CCCACACGATTTTTCTACTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 128, 4: 1572} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!