ID: 1157134341_1157134353

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1157134341 1157134353
Species Human (GRCh38) Human (GRCh38)
Location 18:45039314-45039336 18:45039356-45039378
Sequence CCACAGTGCCTCCCACCAGCCCC TCAGTCTCATCCCTGCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 23, 3: 176, 4: 1133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!