ID: 1157483652_1157483660

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1157483652 1157483660
Species Human (GRCh38) Human (GRCh38)
Location 18:48072405-48072427 18:48072447-48072469
Sequence CCTGGGTGGCTGCATCCATTGGC AACCCCAGCTCACCTTTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 26, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!