ID: 1157866776_1157866782

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1157866776 1157866782
Species Human (GRCh38) Human (GRCh38)
Location 18:51194873-51194895 18:51194922-51194944
Sequence CCCTCCTCACATTGTTCCTCCAC TCCTTCCTACCCATTTTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 411} {0: 1, 1: 0, 2: 4, 3: 24, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!