ID: 1158100013_1158100022

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1158100013 1158100022
Species Human (GRCh38) Human (GRCh38)
Location 18:53819863-53819885 18:53819909-53819931
Sequence CCACTACCACTGCCACAGCAAAG GGAGTTGTTGCCAGAGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 361} {0: 1, 1: 0, 2: 4, 3: 19, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!