ID: 1158354366_1158354375

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1158354366 1158354375
Species Human (GRCh38) Human (GRCh38)
Location 18:56600297-56600319 18:56600339-56600361
Sequence CCTCCAACAGAATATTGAGACTG TTTCAACTCTAATTGTTACGTGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 14, 4: 133} {0: 5, 1: 2, 2: 1, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!