ID: 1158367692_1158367696

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1158367692 1158367696
Species Human (GRCh38) Human (GRCh38)
Location 18:56757153-56757175 18:56757172-56757194
Sequence CCTGCTTGTAAACTGTCACATGG ATGGGAAAACAGAAGTAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 110} {0: 1, 1: 0, 2: 4, 3: 69, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!