ID: 1158441619_1158441630

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1158441619 1158441630
Species Human (GRCh38) Human (GRCh38)
Location 18:57479822-57479844 18:57479853-57479875
Sequence CCCTGTCCCATCTGGGTGTGCCA CAGTGAGCAGGTCCACCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 320} {0: 1, 1: 0, 2: 1, 3: 14, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!