ID: 1158542638_1158542639

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1158542638 1158542639
Species Human (GRCh38) Human (GRCh38)
Location 18:58370554-58370576 18:58370569-58370591
Sequence CCACTTTTATGGGTGTTGCATTC TTGCATTCCATGTGAACAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 134} {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!