ID: 1158670494_1158670501

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1158670494 1158670501
Species Human (GRCh38) Human (GRCh38)
Location 18:59469659-59469681 18:59469672-59469694
Sequence CCTGGCCCTGGCCTGGAAAGGAC TGGAAAGGACTTTCTGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 274} {0: 1, 1: 1, 2: 2, 3: 32, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!