ID: 1158932675_1158932684

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1158932675 1158932684
Species Human (GRCh38) Human (GRCh38)
Location 18:62336410-62336432 18:62336455-62336477
Sequence CCGTCACTTTGGGGACTCCTGGC GCATGGAGGCAGAGCCTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 220} {0: 1, 1: 0, 2: 1, 3: 42, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!