ID: 1158976460_1158976479

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1158976460 1158976479
Species Human (GRCh38) Human (GRCh38)
Location 18:62715600-62715622 18:62715641-62715663
Sequence CCGCCGTCTCCCACCTCCGCCTC CGCTGCCTCCGGAGCTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 199, 4: 1629} {0: 1, 1: 0, 2: 3, 3: 36, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!