ID: 1158976554_1158976565

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1158976554 1158976565
Species Human (GRCh38) Human (GRCh38)
Location 18:62715905-62715927 18:62715927-62715949
Sequence CCCAGGCGAGGCGCCGCCGGGGC CCGCTGCCGGGCAGAGCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 199} {0: 1, 1: 0, 2: 1, 3: 22, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!