ID: 1159051203_1159051213

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1159051203 1159051213
Species Human (GRCh38) Human (GRCh38)
Location 18:63422582-63422604 18:63422617-63422639
Sequence CCGGGAGAAGTAGCCTGGAAGCC GCGGAAGTCGGGCTCGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172} {0: 1, 1: 0, 2: 2, 3: 6, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!