ID: 1159548193_1159548194

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1159548193 1159548194
Species Human (GRCh38) Human (GRCh38)
Location 18:69867136-69867158 18:69867152-69867174
Sequence CCTTTATTTATATTCATATAAAA TATAAAAAACTTAGTTTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 117, 4: 1356} {0: 1, 1: 1, 2: 5, 3: 67, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!