ID: 1159819679_1159819688

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1159819679 1159819688
Species Human (GRCh38) Human (GRCh38)
Location 18:73124398-73124420 18:73124443-73124465
Sequence CCTGTTGATGAGCACCAGGAGCC GAATGATATTTATGGTAAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!