ID: 1159889471_1159889475

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1159889471 1159889475
Species Human (GRCh38) Human (GRCh38)
Location 18:73940319-73940341 18:73940356-73940378
Sequence CCAAGTGACTTGGCAAGGCTGAA AGATCCTGGTAAGTGTATGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!