ID: 1159941641_1159941646

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1159941641 1159941646
Species Human (GRCh38) Human (GRCh38)
Location 18:74413017-74413039 18:74413042-74413064
Sequence CCCAGGACCCTCATCTCCGTGGC TAAGCTGTTCACCTTCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 206} {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!