ID: 1159952593_1159952605

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1159952593 1159952605
Species Human (GRCh38) Human (GRCh38)
Location 18:74496237-74496259 18:74496274-74496296
Sequence CCCTCTGCCTGTGGCTGGATTGG GCGTGGCGATGCCTGCCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 252} {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!