ID: 1159966962_1159966971

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1159966962 1159966971
Species Human (GRCh38) Human (GRCh38)
Location 18:74604369-74604391 18:74604419-74604441
Sequence CCAGGGGTCTTAGGTTTAACTCA TTGAACAGTCTGTGAAGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!