ID: 1160155968_1160155978

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1160155968 1160155978
Species Human (GRCh38) Human (GRCh38)
Location 18:76434016-76434038 18:76434058-76434080
Sequence CCCAACCCAGCACCTGCTGCTCT TCCAGCTGGTCAGGAACTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 68, 4: 489} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!