ID: 1160301969_1160301974

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1160301969 1160301974
Species Human (GRCh38) Human (GRCh38)
Location 18:77690193-77690215 18:77690240-77690262
Sequence CCGTTCTCCTTATTCAGACACCA GGTCAACTTGATTCTGGCCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!